ITS or 16S rRNA Sequencing
Our ITS and 16S rRNA sequencing pipelines provide a culture-free approach for identifying fungal or bacterial species in environmental or laboratory samples. With our optimized automation pipeline, we can generate reads using as few as 11 PCR cycles, which enables more precise frequency counts. This allows for improved accuracy in identifying and quantifying bacterial populations. Users are encouraged to communicate with the DIVA team to get a quote, design and verify the 16S primers, determine the amount of blocker needed (if applicable), and verify the scope of work beforehand.
Turnaround time
As low as 4 business days (depending on sample numbers and queue status).
User Guidance
Our 16S pipeline is optimized based on universal primers that target 16S V3 and V4 regions:
16S Forward Primer: 5'_CCTACGGGNGGCWGCAG
16S Reverse Primer: 5'_GACTACHVGGGTATCTAATCC
As for the ITS pipeline, we use the following primers:
ITS Forward Primer: 5'_CTTGGTCATTTAGAGGAAGTAA
ITS Reverse Primer: 5'_GCTGCGTTCTTCATCGATGC
If you have a preference for using alternative primers for amplification, Please share your custom primer sequences along with the optimal PCR conditions. Please ensure that the region of interest does not exceed a maximum size of 460 bp. The locus specific portion of primer(not including overhang sequence)must have a melting temperature(Tm) of 55°–65°C.
It is important to elute genomic DNA in nuclease-free water to avoid any potential effects on the automation process and to ensure optimal efficiency during library preparation.
Please provide 20 µl of DNA samples in a 384 PCR plate with a concentration ranging from 10 ng/µl to 50 ng/µl, as measured using the Qubit system and leave A1 for a negative control. Please use a NanoDrop spectrophotometer to evaluate the purity of the DNA and use Qubit to measure DNA concentration. It's important to note that the NanoDrop spectrophotometer is suitable for assessing purity only, while the Qubit system is recommended for measuring DNA concentration accurately.
For 16S rRNA seq, if there is a need to block mitochondrial and chloroplast DNA, users may be required to provide DNA blockers. Our R&D findings suggest that a working concentration of 5 µM of DNA blockers (e.g., PNABio.com) effectively blocks mitochondrial and chloroplast DNA in Arabidopsis. Please provide 5 µL of 50 µM blocker per sample. However, if users are working with different organisms, the DIVA team will adhere to their instructions regarding the appropriate blocker concentration.
Label the plate with your lab username, plate number, and the date (YYYYMMDD), e.g. “NJHillson_1_20221010”. Well A1 should be blank and at the top left corner on the plate when you face your label.
Seal the plate securely to avoid cross-contamination, but do not use heat sealers.
It is recommended to use the Bio-Rad foil seals, Microseal 'F' PCR MSF1001, which are available in the ESE main stockroom.
Deliver samples to FRZ-0307 4D, in 4203 (across from the Robotics lab, near the warm rooms).